Review



lenticrisprv2 atg5  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc lenticrisprv2 atg5
    Lenticrisprv2 Atg5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenticrisprv2+atg5/LentiCRISPRv2-ATG5+(Plasmid+%2399573)/pm41770818-499-7-14
    Average 95 stars, based on 130 article reviews
    lenticrisprv2 atg5 - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Liver CYP4A autophagic-lysosomal degradation (ALD): A major role for the autophagic receptor SQSTM1/p62 through an uncommon target interaction site
    Article Snippet: The CRISPR guide RNAs (gRNAs) lentivirus were purchased from Addgene. .. LentiCRISPRv2-ATG5 (Sequences targeting ATG5 exon 7 (CACCGGATGGACAGTTGCACACACT) was a gift from Dr. Edward Campbell (Addgene plasmid #99573; http://n2t.net/addgene:99573 ; RRID: Addgene_99573), and LentiCRISPRv2-Beclin1(Sequences targeting Beclin1 (CACCGATCTGCGAGAGACACCATCC) was also a gift from Dr. Edward Campbell (Addgene plasmid # 99574; http://n2t.net/addgene:99574 ; RRID: Addgene_99574). .. HepG2 cells were cotransfected using X-tremeGENE HP transfection reagent (Roche).

    Article Title: Mutations accumulated in the Spike of SARS-CoV-2 Omicron allow for more efficient counteraction of the restriction factor BST2/Tetherin.
    Article Snippet: .. In order to knockdown ATG5, a CRISPR/Cas9 plasmid targeting this gene, LentiCRISPRv2-ATG5, was obtained through Addgene. ..

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2- ATG5 , a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [ ]. ..

    Article Title: Liver CYP4A autophagic lysosomal degradation: A major role for the autophagic receptor SQSTM1/p62 through an uncommon target interaction site
    Article Snippet: The CRISPR guide RNAs lentivirus were purchased from Addgene. .. LentiCRISPRv2-ATG5 [sequences targeting ATG5 exon 7 (CACCGGATGGACAGTTGCACACACT] was a gift from Dr Edward Campbell (Addgene plasmid #99573; http://n2t.net/addgene:99573 ; RRID: Addgene_99573), and LentiCRISPRv2-Beclin1 [sequences targeting Beclin1 (CACCGATCTGCGAGAGACACCATCC)] was also a gift from Dr Edward Campbell (Addgene plasmid #99574; http://n2t.net/addgene:99574 ; RRID: Addgene_99574). .. HepG2 cells were cotransfected using X-tremeGENE HP transfection reagent (Roche).

    Article Title: RAB5 is a host dependency factor for the generation of SARS-CoV-2 replication organelles
    Article Snippet: HA-tagged full-length and truncated NSP6 constructs were cloned into pcDNA5 (ThermoFisher Scientific, V601020). .. ATG5 KO cells were engineered using LentiCRISPRv2- ATG5 (Addgene plasmid # 99573) ( ). .. COPB1 KO and RAB5 KO cells were generated by transduction of LentiCRISPRv2 (Addgene plasmid # 52961) ( ) harboring the following sgRNAs: COPB1 : 5′- CAGGTTATCAAAGCGCTGAA -3′ and 5′- AGGTAGCACAAAACGAATGA -3′; RAB5 : 5′- CGAGGCGCAACAAGACCCAA -3′ and 5′- GAGGCGCAACAAGACCCAAC -3′. psPAX2 (Addgene plasmid # 12260) and p-MD2-G (Addgene plasmid # 12259) were used to generate lentiviral particles to deliver Cas9 and sgRNAs, as well as to generate stable cell lines, following our previously reported protocols ( , ).

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy.
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2-ATG5, a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [108]. ..

    Article Title: Rapid hepatitis C virus replication machinery removal after antiviral treatment with DAA monitored by multimodal imaging.
    Article Snippet: .. 54 LentiCRISPRv2-ATG5 was a gift from Edward Campbell (Addgene plasmid # 99573; http://n2t.net/addgene:99573; RRID: Addgene_99573). .. DAAs were purchased from Selleckchem.

    Knockdown:

    Article Title: Mutations accumulated in the Spike of SARS-CoV-2 Omicron allow for more efficient counteraction of the restriction factor BST2/Tetherin.
    Article Snippet: .. In order to knockdown ATG5, a CRISPR/Cas9 plasmid targeting this gene, LentiCRISPRv2-ATG5, was obtained through Addgene. ..

    CRISPR:

    Article Title: Mutations accumulated in the Spike of SARS-CoV-2 Omicron allow for more efficient counteraction of the restriction factor BST2/Tetherin.
    Article Snippet: .. In order to knockdown ATG5, a CRISPR/Cas9 plasmid targeting this gene, LentiCRISPRv2-ATG5, was obtained through Addgene. ..

    Knock-Out:

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2- ATG5 , a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [ ]. ..

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy.
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2-ATG5, a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [108]. ..

    Generated:

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2- ATG5 , a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [ ]. ..

    Article Title: HIV-1 Vpr is targeted for degradation by autophagy.
    Article Snippet: .. ATG5 knockout cell lines were generated using LentiCRISPRv2-ATG5, a gift from Dr. Edward Campbell (Addgene plasmid # 99573) [108]. ..



    Similar Products

    95
    Addgene inc lenticrisprv2 atg5
    Lenticrisprv2 Atg5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenticrisprv2+atg5/LentiCRISPRv2-ATG5+(Plasmid+%2399573)/pm41770818-499-7-14
    Average 95 stars, based on 1 article reviews
    lenticrisprv2 atg5 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc lenticrisprv2
    Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lenticrisprv2+atg5/LentiCRISPRv2-ATG5+(Plasmid+%2399573)/pmc10266032__pnas__2219419120__sapp-85-20-21
    Average 95 stars, based on 1 article reviews
    lenticrisprv2 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results